View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11713_high_3 (Length: 239)
Name: NF11713_high_3
Description: NF11713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11713_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 70 - 231
Target Start/End: Original strand, 47458930 - 47459091
Alignment:
| Q |
70 |
ttgtatttgtagtggccagtgatacatccctgcatgagtttctcaacagctttctgcaatttagaagcaggtggtatgatttccctcaccgtggggccag |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47458930 |
ttgtatttgtagtggccagtgatacatccctgcatgagtttctcaacagctttctgcaatttagaagcaggtggtatgatttccctcaccgtggggccag |
47459029 |
T |
 |
| Q |
170 |
agggattgttgctggtgttatttttggagagcatgatttgagccgtcgtgttttcatgatgt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47459030 |
agggattgttgctggtgttatttttggagagcatgatttgagccgtcgtgttttcatgatgt |
47459091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University