View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11713_high_4 (Length: 229)

Name: NF11713_high_4
Description: NF11713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11713_high_4
NF11713_high_4
[»] chr4 (2 HSPs)
chr4 (16-213)||(44188420-44188617)
chr4 (105-212)||(1329654-1329761)


Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 16 - 213
Target Start/End: Complemental strand, 44188617 - 44188420
Alignment:
16 gagattggttattgtatgaacaaggtatggcaaattatgtcccaactactgcatttgcaatctcattagaatgttgtcaaaagaattctttgatatctca 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44188617 gagattggttattgtatgaacaaggtatggcaaattatgtcccaactactgcatttgcaatctcattagaatgttgtcaaaagaattctttgatatctca 44188518  T
116 aacggaccactgatattggtcttgtttagcagccaacaaacttgccttagtgtcccagcattttgtaatgctaattggacctatgatagtgatgatag 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44188517 aacggaccactgatattggtcttgtttagcagccaacaaacttgccttagtgtcccagcattttgtaatgctaattggacctatgatagtgatgatag 44188420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 105 - 212
Target Start/End: Complemental strand, 1329761 - 1329654
Alignment:
105 ttgatatctcaaacggaccactgatattggtcttgtttagcagccaacaaacttgccttagtgtcccagcattttgtaatgctaattggacctatgatag 204  Q
    ||||||||||||  |||||||| || ||||||| |||||||||||||||||||||||||||| | ||||||||||||||||||| |||||||||||||||    
1329761 ttgatatctcaatgggaccactaattttggtctcgtttagcagccaacaaacttgccttagtctgccagcattttgtaatgctagttggacctatgatag 1329662  T
205 tgatgata 212  Q
    ||||||||    
1329661 tgatgata 1329654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University