View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11713_low_9 (Length: 229)
Name: NF11713_low_9
Description: NF11713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11713_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 16 - 213
Target Start/End: Complemental strand, 44188617 - 44188420
Alignment:
| Q |
16 |
gagattggttattgtatgaacaaggtatggcaaattatgtcccaactactgcatttgcaatctcattagaatgttgtcaaaagaattctttgatatctca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44188617 |
gagattggttattgtatgaacaaggtatggcaaattatgtcccaactactgcatttgcaatctcattagaatgttgtcaaaagaattctttgatatctca |
44188518 |
T |
 |
| Q |
116 |
aacggaccactgatattggtcttgtttagcagccaacaaacttgccttagtgtcccagcattttgtaatgctaattggacctatgatagtgatgatag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44188517 |
aacggaccactgatattggtcttgtttagcagccaacaaacttgccttagtgtcccagcattttgtaatgctaattggacctatgatagtgatgatag |
44188420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 105 - 212
Target Start/End: Complemental strand, 1329761 - 1329654
Alignment:
| Q |
105 |
ttgatatctcaaacggaccactgatattggtcttgtttagcagccaacaaacttgccttagtgtcccagcattttgtaatgctaattggacctatgatag |
204 |
Q |
| |
|
|||||||||||| |||||||| || ||||||| |||||||||||||||||||||||||||| | ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1329761 |
ttgatatctcaatgggaccactaattttggtctcgtttagcagccaacaaacttgccttagtctgccagcattttgtaatgctagttggacctatgatag |
1329662 |
T |
 |
| Q |
205 |
tgatgata |
212 |
Q |
| |
|
|||||||| |
|
|
| T |
1329661 |
tgatgata |
1329654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University