View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11714_high_14 (Length: 463)
Name: NF11714_high_14
Description: NF11714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11714_high_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 114; Significance: 1e-57; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 337 - 450
Target Start/End: Original strand, 38097247 - 38097360
Alignment:
| Q |
337 |
attattgatgactctacttagagtcatttatctaattgcaacaacttagaggttgtattcactaggcgacaaactaatgatagtactcctgctttggcac |
436 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38097247 |
attattgatgactctacttagagtcatttatctaattgcaacaacttagaggttgtattcactaggcgacaaactaatgatagtactcctgctttggcac |
38097346 |
T |
|
| Q |
437 |
aaacttctttctct |
450 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
38097347 |
aaacttctttctct |
38097360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 101; E-Value: 7e-50
Query Start/End: Original strand, 163 - 290
Target Start/End: Original strand, 38097020 - 38097152
Alignment:
| Q |
163 |
tctagtctaggtagaatatgtaatgagtacactagcaattataggttgatgcatgtaatattaatttctcttcaaatctcgatt-----tcatcttattt |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| ||||||||||| |
|
|
| T |
38097020 |
tctagtctaggtagaatatgtaatgagtacactagcaattataggttgatgcatgtaatattaatttcttttcaaatcccgatttcatctcatcttattt |
38097119 |
T |
|
| Q |
258 |
agtaaagtgcatttgtgaccttaatgcaagcct |
290 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
38097120 |
agtaaagtgcatttctgaccttaatgcaagcct |
38097152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 19 - 142
Target Start/End: Original strand, 38096847 - 38096967
Alignment:
| Q |
19 |
agttaaaggaaacaaaagaggaaaagagggaggcaaaannnnnnnnagtgaaagagaaatgcataccgcttatgaaatcatccaaagagagtaggaaatg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38096847 |
agttaaaggaaacaaaagaggaaaagagggaggcaaaaggggg---agtgaaagagaaatgcataccgcttatgaaatcatccaaagagagtaggaaatg |
38096943 |
T |
|
| Q |
119 |
atggtgatctggtctggtctggtc |
142 |
Q |
| |
|
||||||||||||| |||||||||| |
|
|
| T |
38096944 |
atggtgatctggtatggtctggtc |
38096967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University