View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11714_high_24 (Length: 352)
Name: NF11714_high_24
Description: NF11714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11714_high_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 324; Significance: 0; HSPs: 5)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 15 - 338
Target Start/End: Complemental strand, 1814078 - 1813755
Alignment:
| Q |
15 |
atgaagaaagtttgaaaggctctagtgctgaattgtccactgaggccttcaacgatcaaaaggactcaagctagtagagaatgctaagactaaagtctaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1814078 |
atgaagaaagtttgaaaggctctagtgctgaattgtccactgaggccttcaacgatcaaaaggactcaagctagtagagaatgctaagactaaagtctaa |
1813979 |
T |
 |
| Q |
115 |
aatggttggctcaaccgtgtgttggcaacatgcttatcaacatctttatgctggctgttctgagattttatatgagaagctgtctaaatttgcttgacat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1813978 |
aatggttggctcaaccgtgtgttggcaacatgcttatcaacatctttatgctggctgttctgagattttatatgagaagctgtctaaatttgcttgacat |
1813879 |
T |
 |
| Q |
215 |
ctaagtgctagttttcagagggattctagcaggccttccttttctcttttgcgacccaaagaacttctattgctatatgcctaagaaacttagatgactt |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1813878 |
ctaagtgctagttttcagagggattctagcaggccttccttttctcttttgcgacccaaagaacttctattgctatatgcctaagaaacttagatgactt |
1813779 |
T |
 |
| Q |
315 |
acaaacaaggtttgtcttgaagtt |
338 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
1813778 |
acaaacaaggtttgtcttgaagtt |
1813755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 112 - 180
Target Start/End: Complemental strand, 39749455 - 39749387
Alignment:
| Q |
112 |
taaaatggttggctcaaccgtgtgttggcaacatgcttatcaacatctttatgctggctgttctgagat |
180 |
Q |
| |
|
||||||||||||||||| | ||||||||| |||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
39749455 |
taaaatggttggctcaaacacttgttggcaaaatgcttatcaacatctttttgctggatgttctgagat |
39749387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 134 - 183
Target Start/End: Complemental strand, 27088724 - 27088675
Alignment:
| Q |
134 |
tgttggcaacatgcttatcaacatctttatgctggctgttctgagatttt |
183 |
Q |
| |
|
||||||||| |||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
27088724 |
tgttggcaaaatgcttatcaacatctttttgctggatgttctgagatttt |
27088675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 134 - 183
Target Start/End: Original strand, 26977961 - 26978010
Alignment:
| Q |
134 |
tgttggcaacatgcttatcaacatctttatgctggctgttctgagatttt |
183 |
Q |
| |
|
||||||||| |||||||||||||||||| |||||| |||||||| ||||| |
|
|
| T |
26977961 |
tgttggcaaaatgcttatcaacatctttttgctggatgttctgaaatttt |
26978010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 134 - 183
Target Start/End: Original strand, 27019693 - 27019742
Alignment:
| Q |
134 |
tgttggcaacatgcttatcaacatctttatgctggctgttctgagatttt |
183 |
Q |
| |
|
||||||||| |||||||||||||||||| |||||| |||||||| ||||| |
|
|
| T |
27019693 |
tgttggcaaaatgcttatcaacatctttttgctggatgttctgaaatttt |
27019742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 134 - 183
Target Start/End: Original strand, 34680358 - 34680407
Alignment:
| Q |
134 |
tgttggcaacatgcttatcaacatctttatgctggctgttctgagatttt |
183 |
Q |
| |
|
||||||||| |||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
34680358 |
tgttggcaaaatgcttatcaacatctttttgctggatgttctgagatttt |
34680407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 112 - 180
Target Start/End: Complemental strand, 1960462 - 1960394
Alignment:
| Q |
112 |
taaaatggttggctcaaccgtgtgttggcaacatgcttatcaacatctttatgctggctgttctgagat |
180 |
Q |
| |
|
||||||||||||||||| | ||||||||| |||||||||||||||||| |||||| ||| ||||||| |
|
|
| T |
1960462 |
taaaatggttggctcaaatatttgttggcaaaatgcttatcaacatctttttgctggatgtactgagat |
1960394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 38 - 183
Target Start/End: Original strand, 11631444 - 11631583
Alignment:
| Q |
38 |
agtgctgaattgtccactgaggccttcaacgatcaaaagg-actcaagctagtagagaatgctaagactaaagtctaaaatggttggctcaaccgtgtgt |
136 |
Q |
| |
|
||||||||||| || | |||||| ||||| |||| ||||| | | |||||| ||||||||||||||| |||| ||||||||||||| ||| |
|
|
| T |
11631444 |
agtgctgaattctcaattgaggctttcaatgatccaaagggaatgaagctaatagagaatgctaagaataaa-------atggttggctcaaatacttgt |
11631536 |
T |
 |
| Q |
137 |
tggcaacatgcttatcaacatctttatgctggctgttctgagatttt |
183 |
Q |
| |
|
|||||| |||||||||||||||||| ||| || ||||| |||||||| |
|
|
| T |
11631537 |
tggcaaaatgcttatcaacatctttttgccggatgttccgagatttt |
11631583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University