View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11714_high_36 (Length: 267)
Name: NF11714_high_36
Description: NF11714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11714_high_36 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 14 - 219
Target Start/End: Complemental strand, 14878545 - 14878340
Alignment:
| Q |
14 |
agaagcataggcggtggcaattttgtgcacgacacacaatacttgaatgataaacgtccaatgaatctaatctatattcaatgcagtggattttcttctg |
113 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
14878545 |
agaaacataggcggtggcaattttgtgtacgacacacaatacttgaatgataaacgtccaatgaatctaatctatattcaatgcactggattttcttctg |
14878446 |
T |
|
| Q |
114 |
atccattccaaatttcacatattttcctgactcattgatatacgatcaccgctcccaaaacatgtctgctttataacttttttggcagtgttatcgacat |
213 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
14878445 |
atccattccaaatttcacatattttcgtgactctttgatatacgatcaccgctcccaaaacatgtcttctttataacttttttggcagtgttatcgacat |
14878346 |
T |
|
| Q |
214 |
gatttt |
219 |
Q |
| |
|
||||| |
|
|
| T |
14878345 |
tatttt |
14878340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University