View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11714_low_17 (Length: 438)
Name: NF11714_low_17
Description: NF11714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11714_low_17 |
 | |
|
| [»] scaffold0140 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0140 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: scaffold0140
Description:
Target: scaffold0140; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 18 - 434
Target Start/End: Original strand, 18803 - 19217
Alignment:
| Q |
18 |
gttaacaaggttagcaattcgtctatctaattacttatcacttttgcattatcccataaattgacattattttgatgttaatgatattatgttaattgtg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
18803 |
gttaacaaggttagcaattcgtctatctaattacttatcacttttgcattatcccttaaattgacattattttgatgttaatgatattatgttgtgggtg |
18902 |
T |
|
| Q |
118 |
cattgatgttagttgtgcctgttttgtttggaacagtttagctttatacatttaagtcatttagtttctagagcttcagagttcaacccttcagtagtat |
217 |
Q |
| |
|
|||| | | ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
18903 |
atttgagtct--tcgtgcctgttttgtttggaacattttagctttatacatttaagtcatttagtttctagagcttcagagttcaaccctttagtagtat |
19000 |
T |
|
| Q |
218 |
tgatgtgaagagattgcaaatttgtgaattggattgaatggtatacggaaatgttactgatcttataaggctgtgttttcattgagagtagaaggcaagc |
317 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
19001 |
tgatgtgaaggggttgcaaatttgtgaattggattgaatggtatacggaaatgttactgaacttataaggctgtgttttcattgagagtagaaggcgagc |
19100 |
T |
|
| Q |
318 |
agagggagagacctagccgttcaggctttcattgagaatttagaggaaaacgagatgagggctttgaggataaagagagattccccgataaaagtgaggg |
417 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||| |||||||||||| |||| ||||||||||||||||| ||||||||||||||||||||||| || |
|
|
| T |
19101 |
agagggagagacctagccgtttagactttcattgagagtttagaggaaaatgagacgagggctttgaggataacgagagattccccgataaaagtgacgg |
19200 |
T |
|
| Q |
418 |
attctcctatgcttctc |
434 |
Q |
| |
|
||||||||||| ||||| |
|
|
| T |
19201 |
attctcctatgtttctc |
19217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University