View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11714_low_43 (Length: 253)
Name: NF11714_low_43
Description: NF11714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11714_low_43 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 20 - 253
Target Start/End: Original strand, 41923077 - 41923310
Alignment:
| Q |
20 |
aacagcaccttcactgttattacccctttcttctgagattgaatgctcaaacttcttaaactctggttttttaattgtagcaacttgaggatgtgtggct |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41923077 |
aacagcaccttcactgttattacccctttcttctgagattgaatgctcaaacttcttaaactctggttttttaattgtagcaacttgaggatgtgtggct |
41923176 |
T |
 |
| Q |
120 |
actggtgcatagattccagaaggtgccacaacttttgtcatttcccctgttgttgttgatgaagctaccccaccatactcttgttgttggacaaaaatgt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41923177 |
actggtgcatagattccagaaggtgccacaacttttgtcatttcccctgttgttgttgatgaagctaccccaccatactcttgttgttggacaaaaatgt |
41923276 |
T |
 |
| Q |
220 |
ttcctacaaggacaaaaggtgctgctgtttgtga |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
41923277 |
ttcctacaaggacaaaaggtgctgctgtttgtga |
41923310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University