View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11714_low_50 (Length: 242)
Name: NF11714_low_50
Description: NF11714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11714_low_50 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 50 - 171
Target Start/End: Complemental strand, 37057701 - 37057580
Alignment:
| Q |
50 |
ccctaattttcagtttcacgcgtgaaagacaagttcaagaaccgcaatctttattggtcaaacagttagctactaccatggactttatgcactcatcaag |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37057701 |
ccctaattttcagtttcacgcgtgaaagacaagttcaagagccgcaatctttattggtcaaacagttagctactaccatggactttatgcactcatcaag |
37057602 |
T |
 |
| Q |
150 |
tcttcaatcaagacttcgtccc |
171 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
37057601 |
tcttcaatcaagacttcgtccc |
37057580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 137 - 224
Target Start/End: Complemental strand, 37057560 - 37057474
Alignment:
| Q |
137 |
tgcactcatcaagtcttcaatcaagacttcgtcccnnnnnnnncttcaaacaagactgaagtctgaaccgaaatcggaattgggatct |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37057560 |
tgcactcatcaagtcttcaatcaagacttcgtcccaaaaaaaacttcaa-caagactgaagtctgaaccgaaatcggaattcggatct |
37057474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University