View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11714_low_56 (Length: 218)
Name: NF11714_low_56
Description: NF11714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11714_low_56 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 20 - 203
Target Start/End: Complemental strand, 46816498 - 46816315
Alignment:
| Q |
20 |
ctctggcaccacaacaagacacaaatgttcctcttttgactccgccatcgccatcggtgtcaacaacgggaagtggccgctcatctctgactccatcatc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
46816498 |
ctctggcaccacaacaagacacaaatgttcctcttttgactccgccatcgccatcggtgtcaacaacgggaagtggccgctcatctttgactccatcatc |
46816399 |
T |
 |
| Q |
120 |
tgccattacatcttacaatgtctcacctactgttctattgattgcactgggatttgttgctctcaaatattactagattctgtg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46816398 |
tgccattacatcttacaatgtctcacctactgttctattgattgcactgggatttgttgctctcaaatattactagattctgtg |
46816315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University