View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11714_low_57 (Length: 206)

Name: NF11714_low_57
Description: NF11714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11714_low_57
NF11714_low_57
[»] chr8 (1 HSPs)
chr8 (104-184)||(43423750-43423829)


Alignment Details
Target: chr8 (Bit Score: 52; Significance: 5e-21; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 104 - 184
Target Start/End: Original strand, 43423750 - 43423829
Alignment:
104 ctccatgattattattaactcaaattctatcnnnnnnnnttatagaaccaagcaacaatagtgttccttccccctatagct 184  Q
    |||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||||||||||||||||    
43423750 ctccatgattattattaactcaaattctatcaaaaaaa-ttatagaaccaagcaacaatagtgttccttccccctatagct 43423829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University