View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11714_low_58 (Length: 205)
Name: NF11714_low_58
Description: NF11714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11714_low_58 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 84 - 189
Target Start/End: Original strand, 40648624 - 40648729
Alignment:
| Q |
84 |
tgacaagagctctgcagctgcaacaaaagctacgggtttaacgggtattgatcatgctaccatgaaacaaaaggtacgatttgaattaaatgaactactc |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
40648624 |
tgacaagagctctgcagctgcaacaaaagctacgggttttacgggtattgatcatgctaccatgaaacaaaaggtacgatttgaattaaatgaactcctc |
40648723 |
T |
|
| Q |
184 |
attagt |
189 |
Q |
| |
|
|||||| |
|
|
| T |
40648724 |
attagt |
40648729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 12 - 86
Target Start/End: Original strand, 40648519 - 40648593
Alignment:
| Q |
12 |
agaagcataggatacagaaatttatgagatcgattatagaggtcctgagactcactcgtttgtgcctccacctga |
86 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40648519 |
agaagcattggatacagaaatttatgagatcgattatagaggtcctgagactcactcgtttgtgcctccacctga |
40648593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University