View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11715_high_13 (Length: 240)
Name: NF11715_high_13
Description: NF11715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11715_high_13 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 106
Target Start/End: Original strand, 1179647 - 1179752
Alignment:
| Q |
1 |
taattaaccctttattttaatacttgacgtttaagtttgctttttattttcatctgaaaatccttcttgagttttaaaataatcaatttaaaatatttaa |
100 |
Q |
| |
|
||||||||| ||||||||||||||| || || ||||||||||||||||||||| ||||||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
1179647 |
taattaaccatttattttaatacttcacattaaagtttgctttttattttcatttgaaaatccttcttgagttttaaaataatcagttcaaaatatttaa |
1179746 |
T |
 |
| Q |
101 |
gaagac |
106 |
Q |
| |
|
|||||| |
|
|
| T |
1179747 |
gaagac |
1179752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University