View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11715_low_18 (Length: 240)

Name: NF11715_low_18
Description: NF11715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11715_low_18
NF11715_low_18
[»] chr6 (1 HSPs)
chr6 (1-106)||(1179647-1179752)


Alignment Details
Target: chr6 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 106
Target Start/End: Original strand, 1179647 - 1179752
Alignment:
1 taattaaccctttattttaatacttgacgtttaagtttgctttttattttcatctgaaaatccttcttgagttttaaaataatcaatttaaaatatttaa 100  Q
    ||||||||| ||||||||||||||| || || ||||||||||||||||||||| ||||||||||||||||||||||||||||||| || |||||||||||    
1179647 taattaaccatttattttaatacttcacattaaagtttgctttttattttcatttgaaaatccttcttgagttttaaaataatcagttcaaaatatttaa 1179746  T
101 gaagac 106  Q
    ||||||    
1179747 gaagac 1179752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University