View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11716_high_18 (Length: 270)
Name: NF11716_high_18
Description: NF11716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11716_high_18 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 17 - 261
Target Start/End: Complemental strand, 30719269 - 30719004
Alignment:
| Q |
17 |
gactcaaattgggcatcatgccctgctgccggtcactttgtttatggtgactatgtat---------------------cttggaagtccaagatgcaat |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
30719269 |
gactcaaattgggcatcatgccctgctgcccgtcactttgtttatggttactatgtatttattggttattctctcatctcttggaagtccaagatgcaat |
30719170 |
T |
 |
| Q |
96 |
ccacagtttcctccctatcaagttctgagctaaatattgtgctcttgctagcctctattatgaattgcactaattgcaacatttgtttgatgatctacgt |
195 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||| |||||||| ||||||||||| |
|
|
| T |
30719169 |
ccacggtttcctccctatcaagttctgagctaaatattatgctcttgctagcctctattatgaattgcactggttgcaatatttgtttcatgatctacgt |
30719070 |
T |
 |
| Q |
196 |
attaaattttcacaacttgtcttctgacaacaaatatgcaatcatctccaccctattccttcttct |
261 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
30719069 |
attacattttcacaacttgtcttccgacaacaaatatgcaatcatctacaccctatcccttcttct |
30719004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University