View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11716_high_21 (Length: 263)
Name: NF11716_high_21
Description: NF11716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11716_high_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 11 - 170
Target Start/End: Complemental strand, 1385667 - 1385505
Alignment:
| Q |
11 |
cagagattagcttcgttgattagatttcatgaaaagcggaaggaacgaaattttgacnnnnnnnttcgttatactgttcgtaaagaagtag---cattga |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
1385667 |
cagagattagcttcgttgattagatttcatgaaaagcggaaggaacgaaattttgacaaaaaaattcgttatactgttcgtaaagaagtagtagcattga |
1385568 |
T |
 |
| Q |
108 |
ggtatggttcttactatcattatttttagattgaacttgtttcgaatatttgtctgcattgaa |
170 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1385567 |
ggtatggttcttactaacattatttttagattgaacttgtttcgaatatttgtctgcgttgaa |
1385505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 188 - 217
Target Start/End: Complemental strand, 1385509 - 1385480
Alignment:
| Q |
188 |
ttgaattatattcgtaaatgcttttggttg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
1385509 |
ttgaattatattcgtaaatgcttttggttg |
1385480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University