View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11716_low_11 (Length: 429)
Name: NF11716_low_11
Description: NF11716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11716_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 20 - 417
Target Start/End: Original strand, 49496003 - 49496390
Alignment:
| Q |
20 |
tatttgaaaagtaattcttccatcgatttttctgtctttgttgtgaacatggattgtagattcgnnnnnnnctcttacacttgaaagataattttgcaaa |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
49496003 |
tatttgaaaagtaattcttccatcgatttttctgtctttgttgtgaacatggagtgtagattcgaaaaaaactcttacacttgaaagataattttgcaaa |
49496102 |
T |
|
| Q |
120 |
gtaatatcaaataccatcaacttttttatttatcatgatttatttaatgataccttacatttatgaacggtggtaaaataaattatacgtgttaaaatta |
219 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49496103 |
gta----------ccatcaacttttttatttatcatgatttatttaatgataccttacatttatgaacggtggtaaaataaattatacgtgttaaaatta |
49496192 |
T |
|
| Q |
220 |
acatcaattaagttcggtgaatatccttttggattaaaatataagcnnnnnnnntccaaaaatatcatatatcacctaaaaactaagaagttgagattac |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49496193 |
acatcaattaagttcggtgaatatccttttggattaaaatataagcaaaaaaaattcaaaaatatcatatatcacctaaaaactaagaagttgagattac |
49496292 |
T |
|
| Q |
320 |
tttattagcttataaaatgttaacttcaaattgatctctataatttataaaattttgtaaaatgatcctcatatgcttcagattgtacatgttcgtct |
417 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
49496293 |
tttattagcttataaaatgttaacttcgaattgatctctataatttataaaattttgtaaaatgatcctcatatgcttcagattgtacacgttcgtct |
49496390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University