View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11716_low_22 (Length: 263)

Name: NF11716_low_22
Description: NF11716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11716_low_22
NF11716_low_22
[»] chr4 (2 HSPs)
chr4 (11-170)||(1385505-1385667)
chr4 (188-217)||(1385480-1385509)


Alignment Details
Target: chr4 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 11 - 170
Target Start/End: Complemental strand, 1385667 - 1385505
Alignment:
11 cagagattagcttcgttgattagatttcatgaaaagcggaaggaacgaaattttgacnnnnnnnttcgttatactgttcgtaaagaagtag---cattga 107  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||   ||||||    
1385667 cagagattagcttcgttgattagatttcatgaaaagcggaaggaacgaaattttgacaaaaaaattcgttatactgttcgtaaagaagtagtagcattga 1385568  T
108 ggtatggttcttactatcattatttttagattgaacttgtttcgaatatttgtctgcattgaa 170  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||    
1385567 ggtatggttcttactaacattatttttagattgaacttgtttcgaatatttgtctgcgttgaa 1385505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 188 - 217
Target Start/End: Complemental strand, 1385509 - 1385480
Alignment:
188 ttgaattatattcgtaaatgcttttggttg 217  Q
    ||||||||||||||||||||||||||||||    
1385509 ttgaattatattcgtaaatgcttttggttg 1385480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University