View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11716_low_4 (Length: 746)
Name: NF11716_low_4
Description: NF11716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11716_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 364; Significance: 0; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 364; E-Value: 0
Query Start/End: Original strand, 19 - 490
Target Start/End: Original strand, 8764867 - 8765336
Alignment:
| Q |
19 |
gtagagtggtttttaattaattatgttttgaattccatcaccannnnnnncttatcatttatgacaatgccggtgaaggtttggaaacagattgttcgcc |
118 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8764867 |
gtagagtggtttttaattaattctgttttgaattccatcaccatttttttcttatcatttatgacaatgccggtgaaggtttggaaacagattgttcgcc |
8764966 |
T |
 |
| Q |
119 |
tacaaaaacgnnnnnnnnnatggggaggatcttagggagggaataaaatatcttgggctagctggtcaaaaatttgtaagctgaaaagagagggtgcttt |
218 |
Q |
| |
|
|||||| | | |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8764967 |
tacaaagaagtttttttg--tggggaggatctaagggagggaataaaatatcttgggctagctggtcaaaaatttgtaagctgaaaagagagggtgcttt |
8765064 |
T |
 |
| Q |
219 |
ggaggtaatagatagatcttgttaacttggccatgtttggtaactagaggtggaggattctagcggagggtgatggcttgtggcgtagtatcttttcagc |
318 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
8765065 |
ggaggtaagagatagatcttgttaacttggccatgtttggtaactggaggtggaggattctagcggagggtgatggcttgtggcgtagtatcttttcatc |
8765164 |
T |
 |
| Q |
319 |
caggtatgggtctgccacgacgtcttgtaattttgggatgagagctaggtctctgaaatctccttcgccctggtggaaaaggggtttctttgctcggctc |
418 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8765165 |
caggtatgggtctgccgcgatgtcttgtaattttgggatgagagctaggtccctgaaatctccttcgccctggtggaaaaggggtttctttgctcggctc |
8765264 |
T |
 |
| Q |
419 |
caagtcgaatttctcttcatattggtttgcagagggcttgtctcgagtggttcgggatggcaggaagatgtc |
490 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
8765265 |
caagtcgaatttctcttcagattggtttgcagagggcttgtcttgagtggtttgggatggcaggaagatgtc |
8765336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 213; E-Value: 1e-116
Query Start/End: Original strand, 489 - 733
Target Start/End: Original strand, 8765625 - 8765869
Alignment:
| Q |
489 |
tctttccgctgcctcaattcaatagggtgggaagtctgaggcggttgttgacccggttgatctgatttggcatagttgggcaccctttaaagttaatcct |
588 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
8765625 |
tctttcagctgcctcaattcaattgggtgggaagtttgaggcggttgttgacccgcttgatctgatttggcatagttgggcaccctctaaagttcatcct |
8765724 |
T |
 |
| Q |
589 |
gcaagttatcctcgatagggccccaactcgtcaaaatctctttaagcgcagggtgatctctaatcaagtaaactttatgtgccctattcgtgaggagaat |
688 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8765725 |
gcaagttatcctcgatagggccccaactcgtcaaaatctctttaagcgcagggtgatctctaatcaagtaaactttatgtgccctattcgtgaggagaat |
8765824 |
T |
 |
| Q |
689 |
gtggaatcagtggatcatctgtttgtcacttgtagggtgatgtcc |
733 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
8765825 |
gtggaatcagtggatcatctttttgtcacttgtagggtggtgtcc |
8765869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University