View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11717_low_10 (Length: 338)
Name: NF11717_low_10
Description: NF11717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11717_low_10 |
 | |
|
| [»] scaffold0007 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0007 (Bit Score: 180; Significance: 4e-97; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 180; E-Value: 4e-97
Query Start/End: Original strand, 14 - 233
Target Start/End: Complemental strand, 22610 - 22391
Alignment:
| Q |
14 |
caaatgttgctagtacatttaacattacttcgtctgacattacccaagattttgtttaaccaagtccctctagaaaatgaataaaaacatacgagactga |
113 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
22610 |
caaatgttgccagtacatttaacattacttcgtctaacattacccaagattttgtttaaccaagtccctctagaaaatgaatagaaacagacgagactga |
22511 |
T |
|
| Q |
114 |
aaaagagatagcaaaggatatggtatatagatgaaacatagaaaagaaaagtcatacacattgtatatcaaagacaatatccaataaaccaataaaacac |
213 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
22510 |
aaaagagatagcaaagggtatcgtatatagatgaaacatcgaaaagaaaagtcatacacattgtatatcaaagacaatattcaataaaccaattaaacac |
22411 |
T |
|
| Q |
214 |
cattcaaccgagggctaccg |
233 |
Q |
| |
|
||| |||||||||||||||| |
|
|
| T |
22410 |
catccaaccgagggctaccg |
22391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University