View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11717_low_14 (Length: 277)
Name: NF11717_low_14
Description: NF11717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11717_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 247; Significance: 1e-137; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 20 - 270
Target Start/End: Complemental strand, 35354484 - 35354234
Alignment:
| Q |
20 |
gtccatcccgagtcctttcggttcttcgacttgtcactgaatcttatcgatgaaaagtgcctaattggacttttttggggcgatttagatttggaaactt |
119 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35354484 |
gtccatcccgagtcctttcggttcttcaacttgtcactgaatcttatcgatgaaaagtgcctaattggacttttttggggcgatttagatttggaaactt |
35354385 |
T |
 |
| Q |
120 |
gagagtccttgttcagtagtttccccatgattcttgtatcctgctctttccttcttggaccaggagtcgagaacctcttctgttcatgcttggcttcctt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35354384 |
gagagtccttgttcagtagtttccccatgattcttgtatcctgctctttccttcttggaccaggagtcgagaacctcttctgttcatgcttggcttcctt |
35354285 |
T |
 |
| Q |
220 |
aaaggtttgagagagagaggtttcaggcaaaggagacaaagatctctgctt |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35354284 |
aaaggtttgagagagagaggtttcaggcaaaggagacaaagatctctgctt |
35354234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 33 - 86
Target Start/End: Complemental strand, 35361357 - 35361304
Alignment:
| Q |
33 |
cctttcggttcttcgacttgtcactgaatcttatcgatgaaaagtgcctaattg |
86 |
Q |
| |
|
||||||||||||||||||| ||||| ||||| |||||||||||||||||||||| |
|
|
| T |
35361357 |
cctttcggttcttcgacttatcactcaatctcatcgatgaaaagtgcctaattg |
35361304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University