View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11717_low_2 (Length: 584)
Name: NF11717_low_2
Description: NF11717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11717_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 70; Significance: 3e-31; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 493 - 570
Target Start/End: Complemental strand, 4015886 - 4015809
Alignment:
| Q |
493 |
gatgatgactctgtcaccagcgttcctccccgacgaactcatctttgaggtactttcatttcttccagtgggatctct |
570 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4015886 |
gatgaagactctgtcaccagcgttcctccccgacgaactcatctttgaggtactttcatttcttccagtgagatctct |
4015809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 130 - 270
Target Start/End: Original strand, 4572220 - 4572358
Alignment:
| Q |
130 |
ggggcttggaatttggattctgacagattggctcgcgattcagtttctgagtattcaagctttgaatttcaattttgttgctgctgaatgtttggtgtgt |
229 |
Q |
| |
|
|||| |||||| ||| |||||| ||||||||| | |||||||||| |||| |||||| || | |||||| |||| |||||| ||||||||||| ||| |
|
|
| T |
4572220 |
ggggtttggaacttgtattctgtcagattggcccctgattcagttt--gagtcttcaagtttcgtatttcagtttttttgctgtggaatgtttggtttgt |
4572317 |
T |
 |
| Q |
230 |
atatctgttcagttttggtcagctagcattggagttgtgca |
270 |
Q |
| |
|
||||||||| |||||||| |||||||||| |||||||||| |
|
|
| T |
4572318 |
ctatctgttctgttttggtgagctagcattagagttgtgca |
4572358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 496 - 575
Target Start/End: Complemental strand, 4017701 - 4017622
Alignment:
| Q |
496 |
gatgactctgtcaccagcgttcctccccgacgaactcatctttgaggtactttcatttcttccagtgggatctctgctcc |
575 |
Q |
| |
|
||||||||||||||| ||| ||||| |||| || |||||| | ||||||||||| |||||||| ||| |||||| |||| |
|
|
| T |
4017701 |
gatgactctgtcaccggcggtcctctccgaggatctcatcgtcgaggtactttcgtttcttcccgtgaaatctcttctcc |
4017622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University