View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11718_high_56 (Length: 265)
Name: NF11718_high_56
Description: NF11718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11718_high_56 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 5 - 212
Target Start/End: Original strand, 34580729 - 34580936
Alignment:
| Q |
5 |
ctggattgtgctctgtgatgtgtagcgatttactttggattgagttctgctttttgtattaccctattggactgttttgtttaactctttggggttgttt |
104 |
Q |
| |
|
||||||||| || |||||||||||||||||| ||||||||||||||||||||||||||||| || ||||||||||||||||||||| |||||||||||| |
|
|
| T |
34580729 |
ctggattgtactttgtgatgtgtagcgatttgttttggattgagttctgctttttgtattactctgttggactgttttgtttaactccttggggttgttt |
34580828 |
T |
 |
| Q |
105 |
tccactgcttttactaggttcggttttatgtcccctccagtgttttgtatttttctcttttattttaatctatttagggtgttgcaaattcttttgcacc |
204 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| | |||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
34580829 |
tccactgcttttaccaggttcggttttatgtcccctcgaatgttttgtatttttctcttttattttaatctacttagggtgttgcggattcttttgcacc |
34580928 |
T |
 |
| Q |
205 |
ccatttgc |
212 |
Q |
| |
|
|||||||| |
|
|
| T |
34580929 |
ccatttgc |
34580936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 161 - 195
Target Start/End: Original strand, 7269785 - 7269819
Alignment:
| Q |
161 |
cttttattttaatctatttagggtgttgcaaattc |
195 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7269785 |
cttttattttattctatttagggtgttgcaaattc |
7269819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University