View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11718_high_63 (Length: 239)
Name: NF11718_high_63
Description: NF11718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11718_high_63 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 20 - 229
Target Start/End: Complemental strand, 43018363 - 43018154
Alignment:
| Q |
20 |
aggtgcaacctaaaaaagtatctaccagcattacaaacaatcgaaatcggatcactgatccaaatagaaataacaattattaattgctccactaatttac |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43018363 |
aggtgcaacctaaaaaagtatctaccagcattacaaacaatcgaaatcggatcactgatccaaatagaaataacaattattaattgctccactaatttac |
43018264 |
T |
 |
| Q |
120 |
aactaatttaataagattaatctcaacaaaagaaatttcaaacataaaataaatttcatacatatatgcaaaatcaaagttgatgtgtcccatctcaatc |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43018263 |
tactaatttaataagattaatctcaacaaaagaaatttcaaacataaaataaatttcatacatatatgcaaaatcaaagttgatgtgtcccatctcaatc |
43018164 |
T |
 |
| Q |
220 |
ctatgctact |
229 |
Q |
| |
|
||| |||||| |
|
|
| T |
43018163 |
ctaagctact |
43018154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University