View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11718_high_68 (Length: 209)
Name: NF11718_high_68
Description: NF11718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11718_high_68 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 16 - 191
Target Start/End: Original strand, 11485543 - 11485718
Alignment:
| Q |
16 |
aaggtagtgggggtgtggttgtgtgtgtggcattatggggctcgatgtcgcattcctattcttttcgtccatctctgggagcgtatggcgggttgttggt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11485543 |
aaggtagtgggggtgtggttgtgtgtgtggcgttatggggctcgatgtcgcattcctattcttttcgtccatctctgggagcgtatggcgggttgttggt |
11485642 |
T |
 |
| Q |
116 |
tatgtgggattcttcaatagtagaggtgtggacctcgtgtagtatggagcatatgttgattattcatgaccgcttt |
191 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11485643 |
tatgtgggattcttcaatagtagagatctggacctcgtgtagtatggagcatgtgttgattattcatgaccgcttt |
11485718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University