View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11718_low_32 (Length: 409)
Name: NF11718_low_32
Description: NF11718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11718_low_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 333; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 333; E-Value: 0
Query Start/End: Original strand, 14 - 350
Target Start/End: Original strand, 42985494 - 42985830
Alignment:
| Q |
14 |
agatagtgaccggaaaataacacaaagccacagctaaataagcaatgatcattcccctccacatggatactttggagggcttttcaggagtggaagggat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42985494 |
agatagtgaccggaaaataacacaaagccacaactaaataagcaatgatcattcccctccacatggatactttggagggcttttcaggagtggaagggat |
42985593 |
T |
 |
| Q |
114 |
tgttgattgaatctccaaaatcacattgtggccagcataaccaaatgcaatatcccccaaagcattaaatatgccaaaaatatttcctgcttttgttgaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42985594 |
tgttgattgaatctccaaaatcacattgtggccagcataaccaaatgcaatatcccccaaagcattaaatatgccaaaaatatttcctgcttttgttgaa |
42985693 |
T |
 |
| Q |
214 |
tatctgctactatattgtacatctggtaaggcacccctgtgaattgaagctatccaagcaatggttgagtagctgttgtatgaaattgttaattaaaatt |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42985694 |
tatctgctactatattgtacatctggtaaggcacccctgtgaattgaagctatccaagcaatggttgagtagctgttgtatgaaattgttaattaaaatt |
42985793 |
T |
 |
| Q |
314 |
cgcatatcagtatttatttaaacttttatggctataa |
350 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42985794 |
cgcatatcagtatttatttaaacttttatggctataa |
42985830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 103 - 177
Target Start/End: Complemental strand, 43854510 - 43854436
Alignment:
| Q |
103 |
gtggaagggattgttgattgaatctccaaaatcacattgtggccagcataaccaaatgcaatatcccccaaagca |
177 |
Q |
| |
|
|||||||||||||||| |||||||||||| | ||||||||| |||||||| ||||||||| ||| || |||||| |
|
|
| T |
43854510 |
gtggaagggattgttgcttgaatctccaacaccacattgtgtccagcataggcaaatgcaacatcacctaaagca |
43854436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University