View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11718_low_52 (Length: 290)
Name: NF11718_low_52
Description: NF11718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11718_low_52 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 19 - 283
Target Start/End: Complemental strand, 35439356 - 35439092
Alignment:
| Q |
19 |
gaagataacattaccgaaaagatccatcattaatctgatcccacacagttgaatgatcaacatcagctgcaaccttatcccaatgtagaggctttagcct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35439356 |
gaagataacattaccgaaaagatccatcattaatctgatcccacacagttgaatgatcaacatcagctgcaaccttatcccaatgtagaggctttagcct |
35439257 |
T |
|
| Q |
119 |
tgtttggccgccacccttctctcttgaactctctcctattacaccctctttgacatttgcttttcctttcggtgctggtggcggtttcatggatgaaatg |
218 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35439256 |
tgtttggccaccagccttctctcttgaactctctcctattacaccctctttgacatttgcttttcctttcggtgctggtggcggtttcatggatgaaatg |
35439157 |
T |
|
| Q |
219 |
aatcccctagactttggaagtggaggtggaccaggtggtggtggtgctgcagctgcttcttctct |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35439156 |
aatcccctagactttggaagtggaggtggaccaggtggtggtggtgctgcagctgctccttctct |
35439092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University