View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11718_low_56 (Length: 272)
Name: NF11718_low_56
Description: NF11718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11718_low_56 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 262
Target Start/End: Complemental strand, 30391279 - 30391019
Alignment:
| Q |
1 |
agctcagttggtagggatattgctaagtgacattgattttggtgcatgctaagtgacattgatggctctgctttggatcatccttctcatggtgtcattg |
100 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30391279 |
agctcagttgttagggatattgctaagcgacattgattttggtgcatgctaagtgacattgatggctctgctttggatcatccttctcatggtgtcattg |
30391180 |
T |
 |
| Q |
101 |
ggattgtgtttcgatctcaccttgctgtttttggaggagctcttgtgcagaatattggttattccatgccctttggaagtagagttcagtgctttcatga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| ||||||| |||||||| ||||||||||| |
|
|
| T |
30391179 |
ggattgtgtttcgatctcaccttgctgtttttagaggagctcttgtgcagaatattggttatgccatgccc-ttggaagcagagttcaatgctttcatga |
30391081 |
T |
 |
| Q |
201 |
ttgcgattgagaaggctcttgaaatgcatgtgaataatatttgggtacaatgtgactctctg |
262 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
30391080 |
ttgcgattgagaaggctcttgaaatgcatatgaataatatttgggtagaatgtgactctctg |
30391019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University