View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11718_low_58 (Length: 253)
Name: NF11718_low_58
Description: NF11718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11718_low_58 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 34632990 - 34633229
Alignment:
| Q |
1 |
ataacgtatcgaggttcgaaacctgatcaaaagaggtgtctcaacgataccttgaataatattacttctagtgatgaaaacttgtagaggnnnnnnntta |
100 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
34632990 |
ataatgtatcaaggttcgaaacctgatcaaaagaggtgtctcaacgataccttgaataatattacttctagtgatgaaaacttgtagaggaaaaaaatta |
34633089 |
T |
|
| Q |
101 |
ttttcgtagaacttaagtcttacattagaaagtgataagacatgtaaagatcttataaaatgt-aatgctctaaatttagaagtcaatttcttatcattg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
34633090 |
ttttcgtagaacttaagtcttacattagaaagtgataagacatgtaaagatcttataaaatgtgaacgctctaaatttagaagtcaatttcttatcattg |
34633189 |
T |
|
| Q |
200 |
aattctaatagcatgtttgttttcatatttactagtctct |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34633190 |
aattctaatagcatgtttgttttcatatttactggtctct |
34633229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University