View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11718_low_65 (Length: 239)
Name: NF11718_low_65
Description: NF11718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11718_low_65 |
 | |
|
| [»] scaffold0187 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0187 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: scaffold0187
Description:
Target: scaffold0187; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 18 - 239
Target Start/End: Original strand, 5793 - 6014
Alignment:
| Q |
18 |
gtagcaatcactatgaattgtgtgttcaaaatttgagttttaccattagttagtggtcgtaggtagaagtttttaacgtaggtgcaagatcgggatcttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5793 |
gtagcaatcactatgaattgtgtgtttaaaatttgagttttaccattagttagtggtcgtaggtagaagtttttaacgtaggtgcaagatcgggatcttg |
5892 |
T |
|
| Q |
118 |
actaccatgctctcaatagtttttaacgcctgcatctccaggcaaaattcgaaaacaaaacctacagttaagctaagagacctgatctcatcaatcactc |
217 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5893 |
actaccatgctctgaatagtttttaacgcctgcatctccaggcaaaattcgaaaacaaaacctacagttaagctaagagacctgatctcatcaatcactc |
5992 |
T |
|
| Q |
218 |
ttggattgttgcagcactattt |
239 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
5993 |
ttggattgttgcagcactattt |
6014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University