View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11718_low_68 (Length: 219)
Name: NF11718_low_68
Description: NF11718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11718_low_68 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 17 - 202
Target Start/End: Original strand, 51839654 - 51839839
Alignment:
| Q |
17 |
aataatgagatcaaattaagtataagatgtgcttaacttaaaatgagcataaagacttgaaaaatggcaaacaaaaccgaatcatcaacaagcagataac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
51839654 |
aataatgagatcaaattaagtataagatgtgcttaacttaaaatgagcataaagacttgaaaaatggcaaacaaaaccaaatcatcaacaagcagataac |
51839753 |
T |
 |
| Q |
117 |
gacattacaggatgaaatactctaaacaaacatctccacaagaatgaaatttcacattgtcaactatatcaacgatggctgattct |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51839754 |
gacattacaggatgaaatactctaaacaaacatctccacaagaatgaaatttcacattgtcaactatatcaacgatggctgattct |
51839839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University