View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11719_low_6 (Length: 272)
Name: NF11719_low_6
Description: NF11719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11719_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 17 - 263
Target Start/End: Complemental strand, 36263510 - 36263264
Alignment:
| Q |
17 |
caaaggacactaccgccaccatcaacaccactgtcaaaacctcatgtggaaaatctagctaggaataaagattcaagctcttctaagaaatgggtggttg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36263510 |
caaaggacactaccgccaccatcaacaccactgtcaaaacctcatgtggaaaatctagctaggaataaagattcaagctcttctaagaaatgggtggttg |
36263411 |
T |
 |
| Q |
117 |
ttggaattgctgttggagctgcattcctgcttcttatcttttttgtgttgttattctgcttttgtcaggagcataagaacnnnnnnnnnttgtcttctgc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
36263410 |
ttggaattgctgttggagctgcattcctgcttcttatcttttttgtgttgttattctgcttttgtcagcagcataagaacaaaaaaaaattgtcttctgc |
36263311 |
T |
 |
| Q |
217 |
agctaccaaaaccaccactgaggaagtctcaaataccaacacaagta |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36263310 |
agctaccaaaaccaccactgaggaagtctcaaataccaacacaagta |
36263264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University