View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1171_low_12 (Length: 251)
Name: NF1171_low_12
Description: NF1171
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1171_low_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 9 - 236
Target Start/End: Original strand, 29174483 - 29174712
Alignment:
| Q |
9 |
gattatacttacattacgttttgttgacttatatatttgttagttaagttaggtctaagtgtttaatcctttttaaagtttatttagttaatgtagttag |
108 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29174483 |
gattaaacttacattacgttttgttgacttatatatttgttagttaagttaggtttaagtgtttaatcctttttaaagtttatttagttaatgtagttag |
29174582 |
T |
 |
| Q |
109 |
gttcaactgatgaaggggattgaaggaaaggaaggatgagagattttgcctgtgtaa--acgtagttgactttgatgaggggagaagatagattttagtg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29174583 |
gttcaactgatgaaggggattgaaggaaaggagggatgagagattttgcctgtgtaattacgtagttgactttgatgaggggagaagatagattttagtg |
29174682 |
T |
 |
| Q |
207 |
aagggaatgtgtaaatttatttatttttct |
236 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |
|
|
| T |
29174683 |
aagggagtgtgtaaatttatttatttttct |
29174712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University