View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1171_low_8 (Length: 292)
Name: NF1171_low_8
Description: NF1171
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1171_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 44; Significance: 4e-16; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 224 - 279
Target Start/End: Complemental strand, 46876121 - 46876066
Alignment:
| Q |
224 |
ataaaaatttaatatcattaaagaattttttgcaagtttgtgtcaccttctcgtct |
279 |
Q |
| |
|
||||||| ||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
46876121 |
ataaaaacttaatatcactaaataattttttgcaagtttgtgtcaccttctcgtct |
46876066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 46876242 - 46876204
Alignment:
| Q |
1 |
cataaccatcagctttatcaaacacacaaaaagctacga |
39 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46876242 |
cataaccatcagctttatcaaacacacaaaaagctacga |
46876204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University