View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11720_high_15 (Length: 285)
Name: NF11720_high_15
Description: NF11720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11720_high_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 101; Significance: 4e-50; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 1 - 121
Target Start/End: Original strand, 36457804 - 36457924
Alignment:
| Q |
1 |
aaataggtagcagaccgaaaatgacattctgcggctggagtttatgctatttagaatgttatagaagttgaacattgtgtattggggttgagtacctcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| || |
|
|
| T |
36457804 |
aaataggtagcagaccgaaaatgacattctctggctggagtttatgctatttagaatgttataaaagttgaacattgtgtattggggttgagtaccttat |
36457903 |
T |
|
| Q |
101 |
gtactcatttgcatcttattt |
121 |
Q |
| |
|
|||||||| |||||||||||| |
|
|
| T |
36457904 |
gtactcatatgcatcttattt |
36457924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 122 - 223
Target Start/End: Original strand, 36458064 - 36458164
Alignment:
| Q |
122 |
ttattttgaattagagcttgctataaattatttctatcacctaggaggagtatgccattggttggataataggctttcactttatgtggctctctatttc |
221 |
Q |
| |
|
|||||| || ||||||||| ||| |||||| || |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36458064 |
ttatttcgacttagagctt-ctacaaattacttgtatcacctaggaggagcatgccattggttggataataggctttcactttatgtggctctctatttc |
36458162 |
T |
|
| Q |
222 |
at |
223 |
Q |
| |
|
|| |
|
|
| T |
36458163 |
at |
36458164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 236 - 267
Target Start/End: Original strand, 36458160 - 36458191
Alignment:
| Q |
236 |
ttcatgataagctttagagaaactaaagtagt |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
36458160 |
ttcatgataagctttagagaaactaaagtagt |
36458191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University