View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11720_high_19 (Length: 229)
Name: NF11720_high_19
Description: NF11720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11720_high_19 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 6 - 229
Target Start/End: Original strand, 624960 - 625183
Alignment:
| Q |
6 |
agcttgtactaaataggacctcttttccttaattaatccatagtcccctatttaggcttggaagtgaaatccaaagcttttcacacaagcttatacattt |
105 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
624960 |
agctagtactaaataggacctcttttccttaattaatccatagtcccctatttaggcttggaagtgaaatccaaagcttttcacacaagcttatacattt |
625059 |
T |
 |
| Q |
106 |
cctttttaattcattgttgaaatgatagattgcttggtagataattgacttcaaacataatcaacatataaaagtctaaaatatggacaggtagcaatag |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
625060 |
cctttttaattcattgttgaaatgatagattgcttggtagataattgacttcaaacataatcaacatataaaagtctaaaatatggacaggtagcaatag |
625159 |
T |
 |
| Q |
206 |
tgctgcaagtttattggccataaa |
229 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
625160 |
tgctgcaagtttattggccataaa |
625183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University