View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11720_high_7 (Length: 443)
Name: NF11720_high_7
Description: NF11720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11720_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 339 - 421
Target Start/End: Complemental strand, 2694108 - 2694024
Alignment:
| Q |
339 |
atgctctgtgttttagtttgctaagcggggtttctnnnnnnnt--gcgcactacaatgcatattatttggttagcatctgggtaa |
421 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2694108 |
atgctccgtgtattagtttgctaagcggggtttctaaaaaaatatgcgcactacaatgcatattatttggttagcatctgggtaa |
2694024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University