View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11720_low_15 (Length: 367)
Name: NF11720_low_15
Description: NF11720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11720_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 18 - 360
Target Start/End: Original strand, 44314251 - 44314584
Alignment:
| Q |
18 |
attaacatcgtgaagtctctctttatggatcaaatactccgttgatcggttgcttccaactgacttgataacatacgtagggtttgcgcggctctgcggc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44314251 |
attaacatcgtgaagtctctctttatggatcaaatactccgttgatcggttgcttccaactgacttgataacatacgtagggtttgcgcggctctgcggc |
44314350 |
T |
|
| Q |
118 |
tgttgtgaccttctactgcttgctggaaattgcttattagaaaccaatttttccttcataggttccttctcagaataatcagaatctgaaagatccttat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44314351 |
tgttgtgaccttctactgcttgctggaaattgcttattagaaaccaatttttccttcataggttccttc---------tcagaatctgaaagatccttat |
44314441 |
T |
|
| Q |
218 |
ccttccttgattttctagtagtagaagctccaactccaagggtcctttgtgcaatagagaaagaggataaccttatgacatttactacaaccttcattga |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44314442 |
ccttccttgattttctagtagtagaagctccaactccaagggtcctttgtgcaatagagaaagaggataaccttatgacatttactacaaccttcattga |
44314541 |
T |
|
| Q |
318 |
tttctcacaaagagattcctcattcttggactttcctatgcta |
360 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44314542 |
tttctcacaaagagattcctcattcttggactttcctatgcta |
44314584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University