View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11720_low_22 (Length: 254)
Name: NF11720_low_22
Description: NF11720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11720_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 10 - 236
Target Start/End: Complemental strand, 40752018 - 40751792
Alignment:
| Q |
10 |
agaagcataggcatgttataatggctagaaaacaaagggaacaatccaagttatgtggcaagagaagttttcaagaagttttttctaactcctctatact |
109 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40752018 |
agaatcattggcatgttataatggctagaaaacaaagggaacaatccaagttatgtggcaagagaagttttcaagaagttttttctaactcctctatact |
40751919 |
T |
|
| Q |
110 |
taatttcccttacaccacaagaattgattatgagaatggaagattctatgataatacaccttctagttctcttgcctcttggaattttgcttctatgtca |
209 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40751918 |
taatttcccttacaccacaagaattggatatgagaatggaagattctatgataatacaccttctagttctcttgcctcttggaattttgcttctatgtca |
40751819 |
T |
|
| Q |
210 |
acaaaaccaaacactactactgcttct |
236 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
40751818 |
acaaaaccaaacactactactgcttct |
40751792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University