View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11720_low_25 (Length: 227)
Name: NF11720_low_25
Description: NF11720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11720_low_25 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 16 - 217
Target Start/End: Original strand, 39878919 - 39879120
Alignment:
| Q |
16 |
gagagggacccttgaggttgagagtgactggtgagactgnnnnnnncacagacctcttcttcaatttctgtttatccatctcatcttctcaactaatttt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39878919 |
gagagggacccttgaggttgagagtgactggtgagactgaaaaaaacacagacctcttcttctatttctgtttatccatctcatcttctcaactaatttt |
39879018 |
T |
|
| Q |
116 |
actgcccactattttccattattatcattctttcattgtcattttttggacaaatatgtcacaatattaaatgctccctttcatcctttctttcccttga |
215 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| || |||| | |||||||||||||||| |
|
|
| T |
39879019 |
actgcccactattttccattattatctttctttcattgtcattttttggacaaatatgtcacaatattaaatgttctctttgaccctttctttcccttga |
39879118 |
T |
|
| Q |
216 |
tg |
217 |
Q |
| |
|
|| |
|
|
| T |
39879119 |
tg |
39879120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University