View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11720_low_9 (Length: 443)

Name: NF11720_low_9
Description: NF11720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11720_low_9
NF11720_low_9
[»] chr2 (1 HSPs)
chr2 (339-421)||(2694024-2694108)


Alignment Details
Target: chr2 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 339 - 421
Target Start/End: Complemental strand, 2694108 - 2694024
Alignment:
339 atgctctgtgttttagtttgctaagcggggtttctnnnnnnnt--gcgcactacaatgcatattatttggttagcatctgggtaa 421  Q
    |||||| |||| |||||||||||||||||||||||       |  ||||||||||||||||||||||||||||||||||||||||    
2694108 atgctccgtgtattagtttgctaagcggggtttctaaaaaaatatgcgcactacaatgcatattatttggttagcatctgggtaa 2694024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University