View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11721_high_45 (Length: 364)
Name: NF11721_high_45
Description: NF11721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11721_high_45 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 332; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 332; E-Value: 0
Query Start/End: Original strand, 1 - 348
Target Start/End: Original strand, 47317902 - 47318249
Alignment:
| Q |
1 |
tctgcattagcctagttgtctaatttcaagacttttatccatactgataccttgctggaggcagataatgcagcaaggttgtcagttgtgcttttctgct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47317902 |
tctgcattagcctagttgtctaatttcaagacttttatccatactgataccttgctggaggcagataatgcagcaaggttgtcagttgtgcttttctgct |
47318001 |
T |
 |
| Q |
101 |
gcaggacactctctcatcaattttgttaatagggacaaacttgaattgaaatattctcgtggttttttcttggcggggaattatgcacagtaaggttttt |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
47318002 |
gcaggacactgtctcatcaattttgttaatagggacaaacttgaattgaaatattctcgtggttttttcttggcgggggattatgcacagtaaggttttt |
47318101 |
T |
 |
| Q |
201 |
tccacttgttttcgttttgggtttagctgattgcctgataagtgataactatagtatgctatcatttgtctttctgtggaagcctaattactgtttgcag |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
47318102 |
tccacttgttttcgttttgggtttagctgattgcctgataagtgataactatagtatgctatcatttgtcattctgtggaagcctagttactgtttgcag |
47318201 |
T |
 |
| Q |
301 |
ccctaagaaattttctacccacttaaatgaaaatcatatggtatttaa |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47318202 |
ccctaagaaattttctacccacttaaatgaaaatcatatggtatttaa |
47318249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University