View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11721_high_61 (Length: 296)
Name: NF11721_high_61
Description: NF11721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11721_high_61 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 11 - 280
Target Start/End: Original strand, 11312258 - 11312527
Alignment:
| Q |
11 |
cataggataaattacctgcatcattgatcatgtgggatgtagctccagaatctacaatgaaggactggtcctttgtgtcatttagagcaagagcagcaag |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11312258 |
cataggataaattacctgcatcattgatcatgtgggatgtagctccagaatctacaatgaaggactggtcctttgtgtcatttagagcaagagcagcaag |
11312357 |
T |
|
| Q |
111 |
tgcctggggaaaatcttcagactgataagaataatcatacctgtaccagcaatcaacagcttcatgattcaattttatgcaaatttgacaagcactttta |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
11312358 |
tgcctggggaaaatcttcagactgataagaataatcatacctgtaccagcaatcaacagcttcatgattcggttttctgcaaatttgacaagcactttta |
11312457 |
T |
|
| Q |
211 |
ctctcgttgatttgacgtggcttttctccctttgaactgtggttatgcttgacgaagacctcgttgtttt |
280 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
11312458 |
ctctcgttgttttgacgtggcttttctccctttgaactgtggttatgcttgacagagaactcgttgtttt |
11312527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University