View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11721_high_62 (Length: 294)
Name: NF11721_high_62
Description: NF11721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11721_high_62 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 18 - 278
Target Start/End: Original strand, 6626467 - 6626727
Alignment:
| Q |
18 |
gttgccccgtagatgttggcatttctggtgcagaccagaattgatttgcttttggtgacacataataatatggcacaaaatcatcttgtttggtgtcata |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6626467 |
gttgccccgtagatgttggcatttctggtgcagaccagaattgatttgcttttggtgacacataataatatggcacaaaatcatcttgtttggtgtcata |
6626566 |
T |
 |
| Q |
118 |
tgggctgattgtgggactggtaaagggagtatttgaagtactagtactccttggagggacacttatccggaagttatttcctcgaaagcctggagctgca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6626567 |
tgggctgattgtgggactggtaaagggagtatttgaagtactagtactccttggagggacacttatccggaagttattccctcgaaagcctggagctgca |
6626666 |
T |
 |
| Q |
218 |
tccccacttgtatcttgacgcacactcctactcccaggtggccttgtctccgcattctctg |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6626667 |
tccccacttgtatcttgacgcacactcctactcccaggtggccttgtctccgcattctctg |
6626727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University