View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11721_high_71 (Length: 252)
Name: NF11721_high_71
Description: NF11721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11721_high_71 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 2633131 - 2633384
Alignment:
| Q |
1 |
ccggcttcgcctttccggagagtttgcctgaatttcaatcagttaatcccttgctgctcatcagacaaatcctaccggtggtgaagttctcggag----- |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2633131 |
ccggcttcgcctttccggagagtttgcctgaatttcaatcagttaatcccttgctgctcatcagacaaatcctaccggtggtgaagttctcggagctgga |
2633230 |
T |
|
| Q |
96 |
-------ctggagctggcggtggagagttgcgccgtctgcctctgtgagttcaaggcggaggatgagatccaacggctcacaaactgccgtcacattttc |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2633231 |
gctggagctggagctggcggtggagagttgcgccgtctgcctctgtgagttcaaggcggaggatgagatccaacggctcacaaactgccgtcacattttc |
2633330 |
T |
|
| Q |
189 |
catagaagctgcctggaccgttggatgggatatgatcacactacatgtcctttg |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2633331 |
catagaagctgcctggaccgttggatgggatatgatcacactacatgtcctttg |
2633384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University