View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11721_high_76 (Length: 245)
Name: NF11721_high_76
Description: NF11721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11721_high_76 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 43258746 - 43258985
Alignment:
| Q |
1 |
cactttcatttcctttcaggtaacaggaaatactcttttttgtacactggaattgcgtttataagccagggcgtcatacttcataatgataatcagataa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||| ||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43258746 |
cactttcatttcctttcaggtaacaggaaatactcttttttgttcaccggaattgtgtttataagccagggcgtcatacttcataatgataatcagataa |
43258845 |
T |
 |
| Q |
101 |
acacacaattggcttaggtaaaatctttttgttcattcaataataatcgaaaaatctgagagaaagacaaactgaacagggacactttaaattcattcag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43258846 |
acacacaattggcttaggtaaaatctttttgttcattcaataataatcgaaaaatctgagagaaagacaaactgaacagggacactttaaattcattcag |
43258945 |
T |
 |
| Q |
201 |
ctttaaattttggtacggttgaacatcccaatgcctatgc |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43258946 |
ctttaaattttggtacggttgaacatcccaatgcctatgc |
43258985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University