View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11721_high_82 (Length: 238)
Name: NF11721_high_82
Description: NF11721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11721_high_82 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 16 - 238
Target Start/End: Original strand, 45201720 - 45201942
Alignment:
| Q |
16 |
gtatttaccaaatttattcatgttggtcgaaggaagtcgatcaacattgaaagcataaagagtttcgattgagcaacctcagcttacttatgtcgaaaga |
115 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45201720 |
gtatttactaaatttattcatgttggtcgaaggaaatcgatcaacattgaaagcataaagagtttcgattgagcaacctcagcttacttatgtccaaaga |
45201819 |
T |
 |
| Q |
116 |
caaggagctagaggaattcatatacagcagtgttttatataaatgtatttctgttaaactttgtattttgattatataagttttactttgtagattggta |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45201820 |
caaggagctagaggaattcatatacagcagtgttttatataaatgtatttctgttaaactttgtattttgattatataagttttactttgtagattggta |
45201919 |
T |
 |
| Q |
216 |
atattttacggtgtgaataagac |
238 |
Q |
| |
|
||||||||| ||||||||||||| |
|
|
| T |
45201920 |
atattttacagtgtgaataagac |
45201942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University