View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11721_high_84 (Length: 237)
Name: NF11721_high_84
Description: NF11721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11721_high_84 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 49807247 - 49807470
Alignment:
| Q |
1 |
tgttgtgggtaatggttccggtgaaggtgaaagattgaagcatcctcttcacaacttccattttccttatttgaagtgggggaatcagcgttctctccgg |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49807247 |
tgttatgggtaatggttccggtgaaggtgaaagattgaagcatcctcttcacaacttccattttccttatttgaagtgggggaatcagcgttctctccgg |
49807346 |
T |
|
| Q |
101 |
tgtcagaagaatcctgaaaacggggacgatccgtcgatggtgtcaccgccggagaataggatgaacagactgagaatcgatggtggtgatgatgggatcg |
200 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
49807347 |
tgtcagaagaatcctgaaaacggtgacgatccgtcgatggtgtcaccgccggagaataggatgaacagactgagaattgatggtggtgatgatgggatcg |
49807446 |
T |
|
| Q |
201 |
atgctatgcgtgaaaggttgatgt |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
49807447 |
atgctatgcgtgaaaggttgatgt |
49807470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 48 - 220
Target Start/End: Complemental strand, 34046544 - 34046373
Alignment:
| Q |
48 |
ttcacaacttccattttccttatttgaagtgggggaatcagcgttctctccggtgtcagaagaatcctgaaaacggggacgatccgtcgatggtgtcacc |
147 |
Q |
| |
|
||||||||||| |||| |||||||||||||||| |||||| |||| ||| ||||| |||| | |||| |||| |||||||||||||||||||| |
|
|
| T |
34046544 |
ttcacaacttcaatttaccttatttgaagtgggcgaatcaacgttacctcaa-tgtcaaaagatttctgacaacgacgacgatccgtcgatggtgtcgtt |
34046446 |
T |
|
| Q |
148 |
gccggagaataggatgaacagactgagaatcgatggtggtgatgatgggatcgatgctatgcgtgaaaggttg |
220 |
Q |
| |
|
||| |||||| ||||| |||| ||| |||||||||||||||||||| |||| ||| | || ||||||||||| |
|
|
| T |
34046445 |
accgaagaataagatgagcagattgataatcgatggtggtgatgatgagatcaatgatgtgtgtgaaaggttg |
34046373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 6 - 86
Target Start/End: Original strand, 34045779 - 34045859
Alignment:
| Q |
6 |
tgggtaatggttccggtgaaggtgaaagattgaagcatcctctt-cacaacttccattttccttatttgaagtgggggaatc |
86 |
Q |
| |
|
|||||||||||||||| |||||||| ||| ||| || ||| || ||||||||| |||| |||| ||||||||||||||||| |
|
|
| T |
34045779 |
tgggtaatggttccggggaaggtgacagaatgacgc-ccctattccacaacttcgatttgccttctttgaagtgggggaatc |
34045859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 20 - 68
Target Start/End: Complemental strand, 2374647 - 2374599
Alignment:
| Q |
20 |
ggtgaaggtgaaagattgaagcatcctcttcacaacttccattttcctt |
68 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |||| ||||||||| |
|
|
| T |
2374647 |
ggtgaaggtgaaagagtgaaggctcctcttcacagcttcaattttcctt |
2374599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University