View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11721_high_88 (Length: 229)
Name: NF11721_high_88
Description: NF11721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11721_high_88 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 5 - 229
Target Start/End: Complemental strand, 40420453 - 40420229
Alignment:
| Q |
5 |
catctccttcatctcatcctttctaaactgatgagagacttcggcttgtacttgttcgtacttcacagagattgccgctcttaagtcaggtatgcattca |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||| ||||||||||||||||||||||| |||||||||||||||||||| ||||||||| | |
|
|
| T |
40420453 |
catctccttcatctcatcctttctaaactgatgaaagatttcgtcttgtacttgttcgtacttcacatagattgccgctcttaagtcaagtatgcattta |
40420354 |
T |
 |
| Q |
105 |
ttgatcgggtggagaccctcaaatatgtcaaccatatcatttctaaatttagtttcagctatcataacaggtgccatatcattgttaagcgggttatatg |
204 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| | | |||||| |
|
|
| T |
40420353 |
ttggtcgggtggagaccctcaaatatgtcaaccatatcatttctaaatttagtttcagctataataacaggtgccatatcattgttaagtgagatatatg |
40420254 |
T |
 |
| Q |
205 |
atcttgtcagtatgaggaaatagaa |
229 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
40420253 |
atcttgtcagtatgaggaaatagaa |
40420229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University