View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11721_low_27 (Length: 518)
Name: NF11721_low_27
Description: NF11721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11721_low_27 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 112; Significance: 2e-56; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 285 - 498
Target Start/End: Complemental strand, 31037022 - 31036802
Alignment:
| Q |
285 |
aaggcaccacacaagctttaagaaacttgaccaatccttaatgtcacataatccaactttgtctcggcttctctatatacttttacacgatacaacattc |
384 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| ||| |
|
|
| T |
31037022 |
aaggtaccacacaagctttaagaaacttgaccaaaccttaatgtcaaataatccaactttgtctcagcttctctatatacttttacacgatacaaccttc |
31036923 |
T |
 |
| Q |
385 |
tctatgtacgatcctttccattcac-------cagcccgccattagaccttacaccaacgcc-ttaccatcaaacgcatttgatgagtcctggtcccaaa |
476 |
Q |
| |
|
||| | |||||| ||||||||||| | |||| |||||||||| ||| |||||||| || ||||| | |||||||||||||||||||||||||| |
|
|
| T |
31036922 |
tctgtatacgattttttccattcactggccctcggccctccattagaccatacgccaacgcctttgccatccagcgcatttgatgagtcctggtcccaaa |
31036823 |
T |
 |
| Q |
477 |
ttattttgagatgctactattg |
498 |
Q |
| |
|
|| |||||||||||||||||| |
|
|
| T |
31036822 |
tt-gtttgagatgctactattg |
31036802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 51 - 109
Target Start/End: Complemental strand, 31037151 - 31037093
Alignment:
| Q |
51 |
gtatagttatctttaagaaggaagaaaatagagctgagtgagaatgttcaaaaaggaat |
109 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31037151 |
gtattgttatctttaagaaggaagaaaatagagctgagagagaatgttcaaaaaggaat |
31037093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 186 - 256
Target Start/End: Complemental strand, 31074289 - 31074219
Alignment:
| Q |
186 |
tgatgtatgctcaaaagaaacttgattcaatttcaatactagtgctcgaaatacttcggttgtctaatgtt |
256 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||| | ||||| ||||| |||| || ||||||||| |
|
|
| T |
31074289 |
tgatgtgtgctcaaaagaaacttaatttaatttcaataccaatgctcaaaataattcgattctctaatgtt |
31074219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University